What is programming in computer science?

Therefore, the importance of the program development sector grows hand in hand with hundreds of thousands of applications and software to be able to use all the new devices that are emerging.

What you will find here: You will understand what it is to program in computer science. What they use to do it, what are the most popular languages ​​and what are all types of programming.

We have become so used to using software in our day-to-day lives that most users suffer from a great dependence on software.

Technology and software are tools that improve our daily lives in many ways, and used in the right way, they can become our best allies.

All these programs, also called applications or more generally software, must obviously be thought out and developed before the user can enjoy them on their device, a task that is carried out by the programmer, a professional who in recent years went from to develop in research centers in the field of large companies and then to develop programs in different areas of the productive economy, making the process one of the most sought after human resources.

As we can, the software these days is the fundamental element so that technology can occupy its place, and the programmer the professional who is capable of shaping the needs of users. If you want to know more about programs, programmers and programming, in this post you will find everything you need to understand this fascinating world.

What is programming?

As we mentioned above, behind all the software we use every day there is a conscientious development and testing process to be able to create and launch a program of any kind. This process is called programming, a task that many consider an art, and it is fundamental for the type of society in which we are immersed today.

Basically, through programming we can establish step by step and through a certain code, the functions that a program will have and how the computer should process said code. For this, a programming language is used, which we will talk about later. What we do in language software after a certain process will become a computer program.

This programming must be guided by orders, instructions and expressions, which as a whole resemble a very basic language, for this reason the software we use to create programs is called a programming language.

This programming is carried out by implementing certain algorithms , which we will also talk about later, which for now we will basically explain as a set of specific rules that must be carried out step by step to achieve a certain objective.

Information technology, as we have already expressed, occupies a place of great importance in modern society, and that is why we must learn, even minimally, what its characteristics are. This is basically for two reasons: The first of these reasons is to understand in greater depth the processes that are carried out in our devices, which would allow us to be able to solve all kinds of problems more easily, and would also allow us to improve the way in how we reason logically.

The second reason to learn programming is that computing can be a very important work environment, and programming can be a more than interesting job opportunity, fundamentally because programming is not a career that is for everyone , that is, they owe you Like numbers and structures, for this reason most of the time this area is restricted to those who are good in areas such as mathematics.

In addition, there will always be the need for a programmer, both for large and small projects, which means that there will be very interesting job opportunities, which are very well paid.

What is the use of programming?

Programming is basically about creating software using programs to create programs (IDEs), using a programming language , with the aim of meeting the computing needs of those who need to solve a problem or implement new features in an organization, company or even private clients.

Learning to program software and doing it well, is an art , since in addition to combining our skills with numbers and all kinds of mathematical operations, we must also use our creativity, intelligence and ingenuity to make our client find what he needs in the program that we are developing, and also feel comfortable doing so.

Despite how easy or obvious it seems to understand what programming is or what programming is for, the truth is that many people are still not clear on either of the two concepts. To help understand what the scope of both ideas means, from this point on we will find information that will be very useful to understand these issues clearly.

As we know, a computer is an incredibly powerful electronic device that can carry out all kinds of tasks. However, it is incapable of doing anything if it does not load and run a program, meaning that an unscheduled computer has the same knowledge value as a blender or other appliance.

This means that all the power hidden in the hard drives, in the RAM memory or in the computer’s processor is waiting for a programmer to provide it with instructions to execute, which is done through a programming language.

Then it could be said that programming is defining certain instructions in a specific order to be executed by a computer and thus obtaining a certain result. With these loose instructions you create a set of behavior rules, called a program.

In response to the question … What is programming for? The best answer we can give is “For everything”.

Although the answer may seem a bit ambiguous, we have to take into account, and this is very relevant, that computers and electronic devices are used by billions of users around the world, that is, they are responsible for and assist us in many of the tasks we do every day, which would take a long time to list.

Electronic devices are everywhere; in industry, commerce, entertainment, culture, education and many other areas, and they are already part of human life to a point where it would be very difficult for us to detach ourselves from their functions. Without a doubt, a fertile field for well-prepared programmers.

Why should you learn to program?

The best answer to this question is found just a little higher in this article. However, there are also other needs to cover for which learning to program from scratch is one of the best ideas we can have for the future.

Programming over the years has become an increasingly sought-after specialty, mainly due to the fact that technology advances and expands, and with it the need for professionals who are capable of creating applications with which to use and take advantage of these hardware developments .

In this sense, the economic development of the programmer has grown exponentially, and it has never been as remunerated as it is now, since with each passing year the employment opportunities in the sector grow, multiplying for each new technology that is created or developed. Learning to develop software today is really very lucrative.

But in addition to the possibility that software programming becomes an excellent source of income , learning to program is also learning to think, since the structure and organization of programming languages ​​will also allow us to face our problems much more. accurate, thanks to reasoning logically, that is, step by step and evaluating each situation separately.

Although the following that we are going to mention may have certain science fiction edges, the truth is that it is a possible scenario.As we know, technology advances by giant steps with fantastic developments such as artificial intelligence and robots, which they will eventually replace us in many of the tasks that are performed today by humans.

Faced with this black scenario, nothing better than to start learning to program, which can assure us a promising future, and those who do not understand this will be stuck. Fortunately, many understand that this scenario is not a movie, and that it may be perfectly possible, and even worse, feasible.

But fundamentally learning to program ensures well-being. Computer science at this level is a field in which monetary retribution is excellent, but it is also much healthier than other fields, since most professionals in the sector work freelance, that is, they do not have to appear every day to work in a workplace that most of the time is harmful. These programmers who took this step work on their own and make their own schedules, which allows them to be masters of their time and their health, both mental and physical.

For all this, learning to program, but taking it seriously and with a view to making ourselves a future, is one of the most interesting work alternatives that we have, since in a short time we will be completely computerized, which will require a legion of programmers to meet all that demand.

How is it programmed?

When reading the benefits that learning to program can offer, it is quite likely that we feel like walking that path, however, the truth is that programming is not easy at all, and it really is for those who really want to accept the challenge starting a career that involves knowledge of multiple disciplines of knowledge.

Of course, if we want to start programming, these pitfalls won’t be a big problem. At this point it is necessary to clarify that neither learning how to program implies having knowledge of quantum physics or very advanced mathematics, it is just a matter of resorting to what we learned in school, and adding it to all the other knowledge that we have been acquiring throughout our life. Of course also higher studies in programming.

Programming can be basically separated into two clearly differentiated aspects: The merely technical, related to learning programming languages, and the commercial aspect of the activity, that is, the ways to better position ourselves to obtain better benefits.

Learning to program is as simple as we really want it to be. It could be said that programming is executing a programming language software, structuring a series of sequences according to the type of language we are using and with this we would end. While this could be summed up this way, the truth is that a good programmer has a knowledge base and a responsibility with what he does that separates him from the rest.

These elements are acquired by learning from the mistakes and successes made during learning and job development, a thorough knowledge of the tools you use to program and above all, being convinced that you have to do things better than anyone else to be able to separate yourself from the rest. To achieve this goal, it is not only necessary to train, but to maintain a professionalism that should make a difference. Being a programmer does not only imply knowing how to program, it is also necessary to carry out a commercial and behavioral policy.

This will allow a programmer who takes things seriously, that is, who is constantly trained to offer the best, learns from his experience and has a work ethic, will always be able to get better job opportunities than others, since he will be able of thinking beyond the strictly technical to provide the perfect software solution for your customer.

In this sense, it is not useful for the programmer, for example, to copy and paste code from other programmers or standard sentences, since it may not meet the client’s requirements. A good programmer will always build his own custom solution, with which he will surely get the best results. And in the same way in all scenarios: do your best so that the customer is satisfied.

But to be able to do this it is necessary to study beyond what is strictly necessary, unfortunately the path that many take. A good programmer will always be up-to-date in his knowledge, he will study all the relevant documentation for each programming language in order to know it perfectly and obtain the best way of doing things.

Basically, a good programmer will always continue to train to be able to carry out his task in the best possible way. At this point, keep learning should always be something the programmer should always keep in mind. In addition, he will study other areas, more related to customer service, such as communication, that is, he knows how to listen and understand what the customer needs, and have the ability to be able to inform the customer about what we did, in addition, the programmer must always put the questions first. needs of the client to their own beliefs or positions.

How many programming languages ​​should I learn?

The answer to this question is basically all that exist. A good programmer must know all the tools available on the market in order to evaluate which one is best suited to a particular job. As we know, computers and other devices are alien to programming languages, since they cannot interpret them directly, for this there are other tools such as assembly languages ​​and others that convert these sequences into binary language, that is, the language that processors understand. and microprocessors.

For this reason we can use a specific programming language for a specific need. In this sense, more experienced programmers have many different programming languages ​​installed on their computers, and they use them according to the needs of the work to be done. Although for those who are just starting out in programming, it is best to learn a flexible programming language that allows them to adapt it to multiple scenarios, over time it will be necessary to learn as many of them as possible, according to our specialization.

However, here we are not talking about taking a look at them to understand more or less how they work. We are saying that it is necessary to learn a programming language completely in order to obtain the best advantages from them, and apply them in the best possible way according to the scenario in which we are going to act, which will allow us to have a better range of action, and therefore better job opportunities.

Algorithms, programs and programming languages

Many computer science or programming students think, especially early in their careers, that when it comes to sets of instructions, algorithms and programs are the same thing.

However, an algorithm and a program are two quite different things. An algorithm could be exemplified as an idea to solve a problem expressed step by step, while a program performs a series of instructions that have been developed through an algorithm.

In addition, a software program can only be executed by an electronic device such as a computer or telephone, since it is in binary language, while an algorithm, being embodied in a language understandable by humans, can be executed by a person. Those are the main differences.

The algorithm, as we mentioned, is a set of instructions developed to solve a specific problem. Basically it is a concept that can be explained through our own language through flow diagrams , which are a graphic description of an algorithm using different figures and lines.

It is also possible to explain them through a technique in which it is necessary to indicate the input and output data and use loop instructions and conditionals of the IF type, called pseudocode , basically a kind of interlocutor between our natural language and a language of programming.

In the case of programs, software or applications , as they are also called, it is always linked to execution by some type of electronic device, since being in binary code they can only be understood by the processors that these devices have to interpret and execute these instructions.

Algorithm example

Algorithm to define if a triangle is scalene, isosceles or equilateral

Input data: side1, side2, side3

Output data: type

if side1 = side2 and side1 = side3

then

type <- equilateral

otherwise

if (side1 = side2) or (side1 = side3) or (side2 = side3)

then

type <- isosceles

otherwise

type <- scalene

Programming examples

If we are taking the first steps in the world of programming , and we want to have all the possible information at hand to be as well prepared as we can, without a doubt one of the first things we have to start with is to know the different languages programming that exist in the market.

In this sense, from this point we will find the most used programming languages ​​in the world , with which we can have an orientation about what we can do with them in order to know which is the one that best adapts to what we want to do.

Java

There is no doubt that Java is one of the most popular programming languages. Launched by Sun Microsystems in 1995, it is one of the most widely used programming languages ​​in all types of implementations, such as web design, games, mobile applications and control software for hundreds of thousands of devices, among others.

Java offers the advantages that it is a multiplatform programming language, it is open source and freely distributed, as well as having a large library. As disadvantages for the user who is just starting, we can mention its syntax, quite complex, and a certain slowness due to the fact that it has to be interpreted.

Java programming example

public class Class_name

{

public static void main (String args [])

{

// statement block;

}

}

JavaScript

JavaScript is a lightweight programming language, also multiplatform and structured, its development is of the “object-oriented” type. For these reasons JavaScript is one of the languages ​​most used by website developers. As advantages we can say that JavaScript is safe and reliable, very complete in features and options, and others very easy to use, which is why it is very suitable for all those who are just starting out in the world of programming. However, it offers certain disadvantages such as certain vulnerabilities related to the visibility of its code, which can be read by anyone who is interested.

JavaScript programming example

<! DOCTYPE html>

<html>

<head>

<title> First program </title>

</head>

<body>

<script>

alert (“Open alert window”);

document.write (“Send content to HTML document”);

</script>

</body>

</html>

C ++

C ++ is an object manipulation programming language that was developed to extend the capabilities of another language, “C”. C ++ is known by developers as one of the best programming tools, mainly due to its flexibility and power.

This programming language is widely used in the development of operating systems, libraries and applications of all kinds. It also offers features such as the ability to compile the code we create on multiple platforms. As disadvantages we can mention that the use of libraries is complicated, as well as memory management, which must be taken care of by the developer. Likewise, it is not a language that can be useful for developing apps or web pages, nor for developing databases, so it is not the best option to start programming.

C ++ programming example

Circumference length = 2 * PI * Radius

Circumference Area = PI * Radius ^ 2

Volume of the sphere = (4/3) * PI * Radius ^ 3

#include <iostream>

#include <iomanip>

#include <cmath>

using namespace std;

int main (void)

{

const float PI = 3.1416;

float radius;

cout << “Enter the value of the radius:”;

cin >> radius;

cout << “\ nLength of circumference:” << fixed << setprecision (2) << 2 * PI * radius;

cout << “\ nArea of ​​the circle:” << PI * pow (radius, 2);

cout << “\ nVolume of the sphere:” << (4.0 / 3) * PI * pow (radius, 3) << endl;

system (“pause”);

PHP

PHP is one of the most used programming languages ​​for web development, very specifically oriented towards the development of dynamic web apps since it is possible to embed it in the HTML code. Its main characteristic is its simplicity of use, which makes it a programming language more than suitable for all those who are starting in the world of programming.

It is a very safe and reliable language, because its source code is hidden from both the browser that runs it and the client. But in addition to security, PHP is very flexible, so it can be used by both experienced programmers and newcomers.

PHP programming example

<! DOCTYPE html>

<html>

<head>

<title> Example </title>

</head>

<body>

<? php

echo “Hello, I am a PHP script!”;

?>

</body>

</html>

If you want to know more about PHP, you can get much more information at this link, which will take you directly to the official PHP site.

Perl

Without a doubt, next to JavaScript, Perl is one of the simplest programming languages ​​that exist. Perl is used very assiduously for the development of CGI (Common Gateway Interface) applications, which is basically a technology that allows a web browser, in this case called a client, to request data from any process running on a web server. Some of the main characteristics of the Perl programming language are its extreme efficiency and very good performance.

However, Perl should not necessarily be used solely in the web environment, as it can also be used for development in other environments. Some of the disadvantages of Perl are that it can be slow compared to other development tools, however this is because the code is compiled at the beginning of the run. Also its code can be difficult to read, and in many cases, it is very difficult to find and isolate errors to polish the program.

Perl programming example

#! / usr / bin / perl -w

# Storing DNA in a variable, and printing it out

# First we store the DNA in a variable called $ DNA

$ DNA = ‘ACGGGAGGACGGGAAAATTACTACGGCATTAGC’;

# Next, we print the DNA onto the screen

print $ DNA;

# Finally, we’ll specifically tell the program to exit.

exit;

Python

Python is an object-oriented programming language widely used to develop all kinds of applications and games for both the web and the desktop. It is multiplatform, freely distributed and really very flexible.

Regarding the advantages of Python, we can mention that it integrates very well with other programming languages ​​such as Java, C or C ++, among others. We could mention as disadvantages that there is not enough documentation, something very necessary and important especially for users who are just starting in the world of programming.

Python programming example

# Exercise 1

print (Juan)

print (‘Birthday: February 11)

age = 30

print (‘I am’, age, ‘years’)

actor = ‘Brad Pitt’

food = ‘Asado’

city ​​= ‘Buenos Aires’

print (‘I like movies by’, actor)

print (‘I like dinner’, food)

print (‘I live in’, city)

Types of programming

Currently there are several ways of approaching software programming, which in turn will depend on the language or technique used. These are called types of programming, and we have several at our disposal, which we can use according to the project we are working on. Although in almost all cases the most used technique is that of modular or structured programming, there are some more types, which we will talk about below.

These types of programming are:

• Structured programming
• Modular programming
• Linear programming
• Object-oriented programming
• Concurrent programming
• Functional programming
• Logic programming

From this point on, we will learn more about each of these types of programming.

Structured programming

The structured programming is basically a set of techniques that allow you without a doubt to the programmer to have a workflow much faster and effective. In structured programming, the software developed is easier to understand, it is not necessary for the testing to be so complex. Also, the code of the programs is much better organized and documented.

These techniques greatly improve the final performance of the product since it is not necessary as much debugging and maintenance time. Part of these techniques involves using fewer control structures, reducing many of the software errors that would otherwise occur.

Other techniques used in structured programming are

• Top-down design (top-dow)
• Abstract resources
• The basic structures, of which there are three types: Sequential structures, Selective structures and Repetitive structures

Modular programming

Another of the known types of programming is the so-called modular programming, which is basically a programming paradigm. To understand what it is to program using modular programming, it is to divide a program into more specific modules or subprograms. This type of programming was developed with the main objective of being able to obtain a much more readable and manipulable code.

In this type of programming , the main program is the part in charge of coordinating the calls to the secondary modules. After that, it passes the necessary data in the form of parameters. It should be noted that each module is capable of containing its own data and calling other modules or functions.

All this means that when we apply modular programming, any complex program can be subdivided into many parts. In other words, a large program can be divided into smaller parts. This offers multiple advantages when it comes to finding errors or modifying part of the code.

Basic operation of modular programming

• Input: Parameter
• Process: Subroutine or function
• Output: Return value

Linear programming

In the field of programming, linear programming is known as a mathematical technique that allows the optimization or minimization of an objective linear function. This is done with the purpose that the variables of the aforementioned function are tied to a certain series of restrictions. These restrictions are expressed by a system of equations or inequalities that are also linear.

In linear programming models, it is established that the decision variables such as the objective function and the restrictions correspond to a linear type of behavior. With this it is possible to facilitate the calculations and get results closer to the real ones.

The most commonly used model to solve linear programming problems is the so-called “Simplex Method”.

Object-oriented programming

The OOP is basically a technique capable of improving in terms of speed and strength software development. This development improvement is due to the reuse of objects that are already loaded in the program.

As we can elucidate, the main element of OOP is the object, which is basically a set of data and programs. They have structure and are part of a larger organization. These objects are capable of containing various types of data, all of them structured. These can be visible or not visible according to the needs of the programmer and the software.

Some of the main characteristics of object-oriented programming are polymorphism and inheritance.

Concurrent programming

In the realm of software development, concurrent programming is a really widely used type of programming. It is used by the developer when he needs to carry out multiple tasks simultaneously. Among the tasks that can be carried out are the ability to control multi-user access to systems and software.

Although it is a much more complicated type of programming, the truth is that if it is carried out correctly, the results obtained are superior. In other words, by implementing this technique, the performance of the software being developed can be significantly improved . This is due to the fact that in concurrent programming, tasks can be developed without having to wait for an execution turn.

However, concurrent programming can also offer certain downsides. An example of this occurs when we have the need to share information between tasks, but as we mentioned, well implemented can be an excellent advantage in many environments.

Functional programming

Like modular programming, functional programming is a programming paradigm , which means that it is a way to solve programming problems. When a developer uses this paradigm, he works mainly with functions, avoiding all kinds of variable data, in addition to preventing states from being shared between functions.

In functional programming all functions are treated as first-class “citizens”. These functions can be assigned to variables, which in turn can be used as input and output of many other functions. All those functions that are capable of taking functions as parameters and returning functions as a result, are considered higher-order functions.

Basically, the premise is that functional programming is what experts consider a “declarative paradigm.” This is so because the programmer focuses on the “What” he is doing and not on the “How”, which would be considered an “imperative approach”.

All this means that the programmer will express his logic without the need for flow control descriptions, that is, we will not use cycles or conditionals.

Logic programming

We could say that logic programming is a type of programming paradigm within the declarative programming paradigm. Currently this type of programming is widely used in the development of artificial intelligence . What is programming with logic programming? It is to use a methodology based on the calculation of predicates, which is a mathematical theory. With this theory it is achieved that a computer can give solutions through the use of rules and logical facts.

In this sense, logic programming has to offer unique programming tools of this paradigm, which allows to develop AI in a more flexible way. In this sense, currently most artificial intelligence applications are developed in this language for that reason. This is mainly because logic programming is very different in its way of thinking from the way we think in the most common programming languages. Basically, what logic programming tries to duplicate is human thought, therefore, it is more natural to organize thoughts in this way than with traditional languages. This however requires a higher level of abstraction.

In logic programming , one does not think in low-level structures such as assignments and repetitions, but in terms of premises and conclusions, reaching problem solving through a set of logical axioms.